INTRODUCTION

A brown algal genus Dictyota J.V. Lamouroux (Dictyotales, Dictyotaceae) is common in tropical to warm temperate regions worldwide (De Clerck and Coppejans 1999; De Clerck et al. 2006; Guiry and Guiry 2017). This genus was established based on D. dichotoma by Lamouroux (1809). At that time, twenty-three species were involved in the genus, but later, most of them were moved to other genera (Papenfuss 1977).

Many species of Dictyota show substantial morphological variations in the generic characteristics, distinguishing it from similar genera (Dilophus J. Agardh, Glossophora J. Agardh, Pachydictyon J. Agardh and Glossophorella Nizamuddin et Campbell) within the tribe Dictyoteae (Hörnig et al. 1992; De Clerck and Coppejans 2003). This suggested a necessary taxonomic revision of the generic delineation of Dictyota (Hörnig et al. 1992; Phillips 1992; De Clerck and Coppejans 2003). Thus, Dictyota merged the four morphologically similar genera on the basis of molecular phylogenetic data (De Clerck et al. 2006; Silberfeld et al. 2014). Instead, two new genera Canistrocarpus De Paula et De Clerck and Rugulopteryx De Clerck et Coppejans which are supported by molecular analysis and combined reproductive and vegetative features were established (De Clerck et al. 2006). Dictyota and the two genera have been recognized in the Dictyoteae (Guiry and Guiry 2017). Dictyota is characterized by parenchymatous flattened thalli with a single apical lenticular growing cell oriented transversely (De Clerck et al. 2006).

A total of 92 species are currently accepted based on the emended generic delineation of Dictyota (Guiry and Guiry 2017), and of these, five species have been recorded in Korea (Lee and Kang 1986; Lee and Hwang 2010; Kim et al. 2013). During the present study, a brown alga belonging to the tribe Dictyoteae was collected from Geoje, located on the southern coast of Korea. Morphological observation and molecular analysis were made to identify this alga. The present study reports on this D. bartayresiana newly re- corded in Korea.

MATERIALS AND METHODS

Samples for the present study were collected from Geoje, located on the southern coast of Korea. All specimens were preserved in 5-10% formalin seawater and pressed on herbarium sheets. A portion of the material was dried and preserved in silica gel for molecular analysis. Species identification was based on thallus morphology following the criteria. Sections of the thallus were mounted in 20% corn syrup for permanent preparation.

Total genomic DNA was extracted from silica-gel-preserved samples using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Before extraction, dried material was crushed with liquid nitrogen using a mortar and pestle. Concentrations of extracted DNA were assessed using gel electrophoresis on a 1% agarose gel. PCR amplifications were performed in a TaKaRa PCR Thermal Cycler Dice with an initial denaturation step at 94℃ for 5 min followed by 35 cycles at 94℃ for 1 min, 56℃ for 1 min, and 72℃ for 2 min and a final extension at 72℃ for 7 min. The reaction volume was 20 μL, consisting of 20 ng of genomic DNA, 2 μL of 10× PCR buffer, 2 μL of 200 μM dNTP, 1 μL of each forward and reverse primer, and 0.5 units of Taq polymerase (Takara Korea, Seoul, Korea). Amplifications were examined using gel electrophoresis in a 1% agarose gel, and amplified rbcL region products were purified using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). The PCR primer was also used for sequencing. It is as follows: rbcL (forward: 5ʹ GGAGGATTAGGGTCCGATTCC 3ʹ, reverse: 5ʹ CTTC CGTCAATTCCTTTAAG 3ʹ) (Lin et al. 2001). The PCR products were moved to Macrogen Sequencing Service for sequencing (Macrogen, Seoul, Korea). Sequences for the rbcL region were aligned using BioEdit (Hall 1999). Phylogenetic analyses were performed using the neighbor-joining (NJ), maximum-likelihood (ML) and maximum parsimony (MP) methods. Bootstrap values were calculated with 1,000 replications. RbcL sequences of other species were obtained from GenBank. Dictyopteris polypodioides was used as an outgroup.

RESULTS AND DISCUSSION

Dictyota bartayresiana J.V. Lamouroux 1809: 43

Type locality: Antilles, West Indies (Silva et al. 1996: 586)

Korean name: Seom-geu-mul-ba-tang-mal nom. nov. (신칭: 섬그물바탕말)

Specimens examined: NIBRAL0000143297, PKNU 0000 134883-PKNU 0000134886, PKNU0000143294 (Jeoguri, Geoje: 8.v.2015)

Habitat: Epilithic near the intertidal

Morphology: Thalli erect or prostrate, 3-7 cm high, flattened, attached by mat-like basal filamentous rhizoids, without stoloniferous holdfasts, crisp in texture, dark brown (Fig. 1A); iridescence absent; branches dichotomous to subdichotomous, without dentate margin, not twisted at the terminal part, without surface proliferations (Fig. 1B); interdichotomies 1-2 cm length, 0.3-0.8 cm width, with a 2.5- 3.3 ratio; branch apex rounded, with a single lenticular growing cell oriented transversely (Fig. 1C); cortex pigmented, 1-2 cell layered in the upper portion, 1-3 cell layered in the middle portion, 2-3 cell layered in the lower portion (Fig. 1F); cortical cells 10-20 μm×10-25 μm; medulla not pigmented, unilayered throughout the thallus (Fig. 1F); medullary cells rectangular, with thick walls, 800-1,100 μm× 900-1,200 μm at the upper portion, 1,200-1,400 μm×900- 1,200 μm at the lower portion; sporangia formed solitary only on single sides of branches, subtended by a single stalk cell, without involucrum, 80-120 μm in diam (Fig. 1D, E). Antheridia and oogonia were not observed during the present study.

The morphological features, such as the numbers of layers in the medulla and cortex and the relative abundance of surface proliferations, had been adopted for the traditional generic classification within the tribe Dictyoteae (De Clerck and Coppejans 1997, 1999). However, these features are not practical in delineating the genera, because of substantial variations (Hörnig et al. 1992; Phillips 1992; De Clerck and Coppejans 2003). Therefore, the four similar genera Dilophus, Glossophora, Pachydictyon, and Glossophorella were merged to Dictyota based on molecular phylogenetic data (De Clerck et al. 2006; Silberfeld et al. 2014). Instead, two new genera, Canistrocarpus and Rugulopteryx, were proposed with an emendation to the broad generic concept of Dictyota (De Clerck et al. 2006). Dictyota involves the species characterized by parenchymatous, flattened thalli with apical lenticular growing cells oriented transversely, while the two genera are morphologically supported by the combination of cortex and medulla structure, presence or absence of surface proliferations, numbers of stalk cells and developmental state of the involucrum in sporangia, and antheridial and oogonial features (De Clerck et al. 2006). Our Korean specimens share the morphological features of Dictyota.

In certain species, cell sizes and ratios in the mature parts of thalli are useful (Weber-Peukert 1985; Hörnig et al. 1992). Numbers of sporangial stalk cells and sizes of sporangia and spores were also evaluated for taxonomic characters (Phillips 1992). Of these, the number of sporangial stalk cells is especially significant for discriminating among notoriously difficult species (Phillips 1992). Our Korean alga shows the cortical cell dimension of 10-25 μm and a ratio of 1.2-1.8. It has sporangia of 80-120 μm in size subtended by a single stalk cell and lacking a conspicuous involucrum of sterile cells. Surface proliferations are not found in the thalli. De Clerck and Coppejans (1997) also reported these features in D. bartayresiana after verification of the type specimen.

According to Tsuda (2004), three growth forms, such as compact prostrate clumps, loose prostrate mats with narrow branches and extremely long inter-nodes and straggly twisted thalli, are found in D. bartayresiana from Micronesia. The specimens in this study showed the second loose mat form in habit (Fig. 1A, B), even though not typical. The branches are not so much narrow and long at the inter-nodes (Fig. 1A, B). Unlike in Micronesian species, terminal branches, which are spirally twisted, were also not observed in the Korean specimens (Fig. 1A, B).

The alga collected from Geoje, Korea, during the present study is referable to D. bartayresiana based on the morphological features. This is also supported by molecular analysis (Figs. 2, 3). In the phylogenetic tree based on rbcL sequences, this Korean alga nests in the same clade with D. bartayresiana. Genetic distance between both sequences within the clade was calculated as 1.2%. Considering that the inter-species divergence ranged from 1.8% to 10.6% in Dictyota (the present study), this value is involved in the intra-species range. Based on these morphological and molecular analyses, this Korean alga is identified as D. bartayresiana described originally from Antilles, the West Indies. This is the first record of D. bartayresiana in Korea.