INTRODUCTION

Ulva, which is frequently seen in blooms called green tides caused by a huge proliferation of biomass (Blomster et al. 2002), is distributed globally in coastal areas (Hayden et al. 2003;Guiry and Guiry 2019). This genus shows highly morphological variations with habitat (van den Hoek et al. 1995).

Nevertheless, Ulva species have been distinguished by gross morphology, cell shape and size, plastid orientation, pyrenoid number per cell, and presence or absence of marginal denticulations (Koeman and van den Hoek 1981;Maggs et al. 2007;Loughnane et al. 2008). However, because of their simple and plastic morphology, it is often difficult to identify them by the features (Loughnane et al. 2008;Matsumoto and Shimada 2015). Recently, analyses of the internal transcribed spacer (ITS) region have provided good phylogenetic resolution at the species level in Ulva (Coat et al. 1998;Loughnane et al. 2008;Heesch et al. 2009;Duan et al. 2012).

More than 120 species around the world are currently accepted taxonomically (Guiry and Guiry 2019). Of these, 16 species have been recorded in Korea (Lee and Kang 1986, 2002;Lee 2008;Bae 2010;Kim et al. 2013;Lee et al. 2014;An and Nam 2017). During a survey of marine algal flora, a species of Ulva was collected from Uljin in Korea. Based on morphological and molecular analyses, it was identified as U. sublittoralis, which is newly recorded in the marine algal flora of Korea in the present study.

MATERIALS AND METHODS

Samples were collected from Uljin located on the eastern coast of Korea. They were preserved in 5% formalin seawater with herbarium specimens. A portion of the material was dried and preserved in silica gel for molecular analysis. Microscopic sections were mounted in 30% corn syrup for permanent preparation. Total genomic DNA was extracted from silica-gel-preserved sample using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Extracted DNA were assessed by using gel electrophoresis on a 1% agarose gel and used for amplification of the internal transcribed spacer (ITS) region using published primers (Ogawa et al. 2013) and primer sequences are represented as follows: ITS primers (F: 5ʹ TCTTTGAAACCGTATCGTGA 3ʹ R: 5ʹ GGTGAACCTGCGGAGGGAT 3ʹ). PCR amplifications were performed in a TaKaRa PCR Thermal Cycler Dice (Ta- KaRa Bio Inc., Otsu, Japan) with an initial denaturation step at 94°C for 1 min, 35 cycles at 94°C for 30 s, 55°C for 1 min and 68°C for 2 min and a final extension at 72°C for 5 min. The reaction volume was 30 μL, consisting of 20 ng of genomic DNA, 2 μL of 10× PCR buffer, 2 μL of 200 μM dNTP, 2 μL of each forward and reverse primer, and 0.5 units of Taq polymerase (TaKaRa Bio Inc.). Amplifications were examined using gel electrophoresis in a 1% agarose gel and amplified ITS region products were purified using a QIAquick Gel Extraction Kit (Qiagen). The PCR products were moved to Macrogen Sequencing Service for sequencing (Macrogen, Seoul, Korea). The PCR primers were also used for sequencing. Sequences for the ITS region were aligned using BioEdit (Hall 1999). Phylogenetic analyses were performed using the maximum-likelihood (ML) methods. Bootstrap values were calculated with 1,000 replications. ITS sequences of other species were obtained from GenBank. Umbraulva japonica was used as an outgroup.

RESULTS AND DISCUSSION

Ulva sublittoralisSegawa 1938: 132

Korean name: Dong-hae-gal-pa-rae nom. nov.

(신칭: 동해갈파래)

Specimens examined: MGARB012870, MGARB012 871, MGARB012872 (Mangyang-ri, Uljin, 28 July 2016), MGARB012878-012880 (Mangyang-ri, Uljin, 26 Sep. 2019)

Type locality: Kozu-sima, Japan

Habitat: Epilithic near the intertidal.

Morphology: Thalli 5-15 cm broad, mostly irregularly orbicular or expanded, dark to medium green in color (Fig. 1a, b), distromatic (Fig. 1c); margin entire, without serrations, undulate or strongly ruffled to plane (Fig. 1d); vegetative cells rectangular to polygonal in the basal region of the thallus (Fig. 1e), but irregularly polygonal with 3-6 distinctly rounded corners in the upper basal region; chloroplasts completely covering the outer cell wall, often containing many large starch grains, variously oriented to side of the outer cell wall; pyrenoids, one to two per cell, 3-8 μm in diam.; numerous rhizoidal cells present in the basal region of the thallus, bearing tubular extensions on the outside of the cell layer (Fig. 1f).

Ulva sublittoralis, which is distributed throughout temperate regions (Guiry and Guiry 2019), was originally described from Japan (Silva et al. 1996). According to previous reports (Segawa 1938;Bliding 1963;Brodie et al. 2007), it appears to be generally characterized by an irregularly expanded thallus normally with entire margin. Our specimens collected from Korea basically share this morphological feature. Even though some dissimilarities between them are found, such as in gross morphology and chloroplast shape (Segawa 1938;Ogawa et al. 2013;Phillips et al. 2016; the present study), the Korean alga is considered to be Ulva sublittoralis. This is also supported by molecular analysis (Fig. 2).

In morphology, this species is very similar to U. pertusa, which has been reduced to a synonym of U. australis Areschoug from South Australia. However, U. sublittoralis genetically differs from U. australis based on ITS sequence (Kirkendale et al. 2013;Ogawa et al. 2013; the present study). According to Ichihara et al. (2009), rhizoidal cells in most species of Ulva bear tubular extensions in the inside of the cell layer in longitudinal sections of the lower thallus (Bliding 1968;Koeman and van den Hoek 1981, 1982;Phillips 1988;Hiraoka et al. 2004). However, Ulva sublittoralis Segawa and U. limnetica Ichihara et Shimada described from Japan produce tubular extensions on the outside of the cell layer in the stipe (Ichihara et al. 2009). It is also similar to Ulva limnetica in sharing this feature (Ichihara et al. 2009). However, it was confirmed that both species are readily distinguished from each other by interspecific genetic distance level of 16.3% in the present study. They are currently accepted (Guiry and Guiry 2019).

In general, ITS regions have been used to analyze molecular phylogeny in Ulva (Malta et al. 1999;Hayden et al. 2003;Hayden and Waaland 2004;Hofmann et al. 2010;O’Kelly et al. 2010). In a phylogenetic tree based on the molecular data (Fig. 2), our specimens nest in the same clade with U. sublittoralis from Japan, as a sister clade of some species groups (U. californica and U. tanneri from USA and U. flexuosa from Italy), which share the irregularly orbicular or expanded thallus normally without teeth cells. The genetic distance between them within the clade was 0.01%.

According to Kirkendale et al. (2013), the interspecific genetic distance is 0.9-5.56% in Ulva. The present analysis shows a divergence range of 1.2%-21.9%. This suggests that the distance between sequences of the Korean specimens and U. sublittoralis is intraspecific. Based on these morphology and molecular data, our Korean specimens are identified as U. sublittoralis, which is newly recorded in the Korean marine algal flora.